Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 680718
End position: 680747
Length: 30

DNA sequence
>NC_018828, from 680718 to 680747 (30 bp); Bordetella parapertussis Bpp5 GGGCGCGCGAGGGCGCGCCGGAGCCCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 680000-681034	Sequence	BN117_0630 - hypothetical protein (Protein is coded in complementary strand; from 681034 to 680000)