Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1075059
End position: 1075088
Length: 30

DNA sequence
>NC_018828, from 1075059 to 1075088 (30 bp); Bordetella parapertussis Bpp5 CTGTCGCGGCCTGCCGCGCCTTGTCGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1074554-1076197	Sequence	BN117_0982 - hypothetical protein (Protein is coded in complementary strand; from 1076197 to 1074554)