Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1239595
End position: 1239618
Length: 24

DNA sequence
>NC_018828, from 1239595 to 1239618 (24 bp); Bordetella parapertussis Bpp5 GCATAGCCATAGTCATAGTCATAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1239517-1239867	Sequence	BN117_1132 - hypothetical protein (Protein is coded in complementary strand; from 1239867 to 1239517)