Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1251640
End position: 1251663
Length: 24

DNA sequence
>NC_018828, from 1251640 to 1251663 (24 bp); Bordetella parapertussis Bpp5 GCGGCCGCTGCCGCGACCGCGGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1251112-1252386	Sequence	BN117_1144 - inner membrane protein (Protein is coded in complementary strand; from 1252386 to 1251112)