Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1252899
End position: 1252922
Length: 24

DNA sequence
>NC_018828, from 1252899 to 1252922 (24 bp); Bordetella parapertussis Bpp5 GGGGCGGGGGAGGGGGCGGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1252383-1252928	Sequence	BN117_1145 - inner membrane protein (Protein is coded in complementary strand; from 1252928 to 1252383)