Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1369702
End position: 1369728
Length: 27

DNA sequence
>NC_018828, from 1369702 to 1369728 (27 bp); Bordetella parapertussis Bpp5 GCCAGCGCCGCCACCGCCGCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1368805-1369752	Sequence	BN117_1248 - high-affinity branched-chain amino acid transporter membrane protein (Protein is coded in complementary strand; from 1369752 to 1368805)