Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1469726
End position: 1469749
Length: 24

DNA sequence
>NC_018828, from 1469726 to 1469749 (24 bp); Bordetella parapertussis Bpp5 CGCCAGCCCCAGCGCCACCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1469235-1470134	Sequence	BN117_1347 - hypothetical protein (Protein is coded in complementary strand; from 1470134 to 1469235)