Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1751162
End position: 1751197
Length: 36

DNA sequence
>NC_018828, from 1751162 to 1751197 (36 bp); Bordetella parapertussis Bpp5 GGCAGCGTCCCAGGCAGCGTCCCAGGCAGCGTCCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1750950-1751849	Sequence	BN117_1610 - phage-related hypothetical protein (Protein is coded in complementary strand; from 1751849 to 1750950)