Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 1752439
End position: 1752483
Length: 45

DNA sequence
>NC_018828, from 1752439 to 1752483 (45 bp); Bordetella parapertussis Bpp5 CGCGTCGGCCAGGTACGCGTCGGCCAGGTACGCGTCGGCCAGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1751888-1752772	Sequence	BN117_1611 - hypothetical protein (Protein is coded in complementary strand; from 1752772 to 1751888)