Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 183918
End position: 183953
Length: 36

DNA sequence
>NC_018828, from 183918 to 183953 (36 bp); Bordetella parapertussis Bpp5 TCATGGCCGTGGCCGTGGCCGTGGCCATGGTCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 183543-184664	Sequence	BN117_0178 - hypothetical protein (Protein is coded in complementary strand; from 184664 to 183543)