Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2212350
End position: 2212373
Length: 24

DNA sequence
>NC_018828, from 2212350 to 2212373 (24 bp); Bordetella parapertussis Bpp5 CGTCGTCGTCCTCGTCCTCGTCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2212337-2212609	Sequence	BN117_2026 - hypothetical protein (Protein is coded in complementary strand; from 2212609 to 2212337)