Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2259121
End position: 2259156
Length: 36

DNA sequence
>NC_018828, from 2259121 to 2259156 (36 bp); Bordetella parapertussis Bpp5 CTGGCAGCGGCCCTGGCAGCGGCCCTGGCAGCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2258971-2259870	Sequence	BN117_2074 - phage-related hypothetical protein (Protein is coded in complementary strand; from 2259870 to 2258971)