Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2260460
End position: 2260504
Length: 45

DNA sequence
>NC_018828, from 2260460 to 2260504 (45 bp); Bordetella parapertussis Bpp5 CGCGTCGGCCAGGTACGCGTCGGCCAGGTACGCGTCGGCCAGGTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2259909-2260898	Sequence	BN117_2075 - hypothetical protein (Protein is coded in complementary strand; from 2260898 to 2259909)