Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 230362
End position: 230385
Length: 24

DNA sequence
>NC_018828, from 230362 to 230385 (24 bp); Bordetella parapertussis Bpp5 CAGGATCAGGAACGGGATCAGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 229475-230539	Sequence	BN117_0225 - branched-chain amino acid ABC transporter permease (Protein is coded in complementary strand; from 230539 to 229475)