Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2508737
End position: 2508760
Length: 24

DNA sequence
>NC_018828, from 2508737 to 2508760 (24 bp); Bordetella parapertussis Bpp5 CCAGCAGCAGCACCATCAGCAGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2508091-2509782	Sequence	BN117_2316 - sulfate transporter (Protein is coded in complementary strand; from 2509782 to 2508091)