Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2511120
End position: 2511143
Length: 24

DNA sequence
>NC_018828, from 2511120 to 2511143 (24 bp); Bordetella parapertussis Bpp5 AGCAGGGGCAGGATCAGGGGCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2510760-2511218	Sequence	BN117_2318 - hypothetical protein (Protein is coded in complementary strand; from 2511218 to 2510760)