Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2552863
End position: 2552898
Length: 36

DNA sequence
>NC_018828, from 2552863 to 2552898 (36 bp); Bordetella parapertussis Bpp5 GCCATGGTCGTGGGCATGGTCGTGGGCATGGTCGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2550710-2552995	Sequence	BN117_2362 - membrane transport ATPase (Protein is coded in complementary strand; from 2552995 to 2550710)