Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2592066
End position: 2592119
Length: 54

DNA sequence
>NC_018828, from 2592066 to 2592119 (54 bp); Bordetella parapertussis Bpp5 CGGTCCCGGCTCCGGCCCCGGCCCCGGCGCCGGCGCCGGCTCCGGCTCCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2591424-2593085	Sequence	BN117_2395 aceF dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex