Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2707830
End position: 2707865
Length: 36

DNA sequence
>NC_018828, from 2707830 to 2707865 (36 bp); Bordetella parapertussis Bpp5 CGGCCAGCCCCACGGCCAGCATCACCGCCAGCCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2707202-2708167	Sequence	BN117_2516 - sugar ABC transporter permease (Protein is coded in complementary strand; from 2708167 to 2707202)