Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2826767
End position: 2826790
Length: 24

DNA sequence
>NC_018828, from 2826767 to 2826790 (24 bp); Bordetella parapertussis Bpp5 TCGCCAGCGCCAACGCCAGCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2826337-2827575	Sequence	BN117_2641 livM high-affinity branched-chain amino acid transporter permease (Protein is coded in complementary strand; from 2827575 to 2826337)