Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 2995089
End position: 2995112
Length: 24

DNA sequence
>NC_018828, from 2995089 to 2995112 (24 bp); Bordetella parapertussis Bpp5 TGCGCCTGCTCCAGCGCCAGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2994666-2995172	Sequence	BN117_2772 cumB zinc-binding hydrolase (Protein is coded in complementary strand; from 2995172 to 2994666)