Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3096915
End position: 3096938
Length: 24

DNA sequence
>NC_018828, from 3096915 to 3096938 (24 bp); Bordetella parapertussis Bpp5 CGCCGGCGACGGCGCCAGCGCCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3095818-3097500	Sequence	BN117_2869 ilvB acetolactate synthase large subunit (Protein is coded in complementary strand; from 3097500 to 3095818)