Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3134913
End position: 3134945
Length: 33

DNA sequence
>NC_018828, from 3134913 to 3134945 (33 bp); Bordetella parapertussis Bpp5 TGTACCGCCACTGTACCGAAACTGTACCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3133795-3134997	Sequence	BN117_2912 - phage integrase family site specific recombinase (Protein is coded in complementary strand; from 3134997 to 3133795)