Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3230506
End position: 3230530
Length: 25

DNA sequence
>NC_018828, from 3230506 to 3230530 (25 bp); Bordetella parapertussis Bpp5 CGCGGCGCGGCGCTGCTCGGCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3229991-3232705	Sequence	BN117_2992 polA DNA polymerase I (Protein is coded in complementary strand; from 3232705 to 3229991)