Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3244673
End position: 3244717
Length: 45

DNA sequence
>NC_018828, from 3244673 to 3244717 (45 bp); Bordetella parapertussis Bpp5 GCCTCGTCGGCGCCGGCTTCGCCGGCGGCGGCCGCGTCGCCGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3243173-3244903	Sequence	BN117_3002 - hypothetical protein (Protein is coded in complementary strand; from 3244903 to 3243173)