Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3245396
End position: 3245422
Length: 27

DNA sequence
>NC_018828, from 3245396 to 3245422 (27 bp); Bordetella parapertussis Bpp5 CCTCGACCGCATCGACCGCCTCGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3244900-3245994	Sequence	BN117_3003 - hypothetical protein (Protein is coded in complementary strand; from 3245994 to 3244900)