Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3340433
End position: 3340468
Length: 36

DNA sequence
>NC_018828, from 3340433 to 3340468 (36 bp); Bordetella parapertussis Bpp5 TGTCGTACGGGATGTCGTAGCGGATGTTGGACGGGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3338188-3341418	Sequence	BN117_3100 - efflux system transmembrane protein (Protein is coded in complementary strand; from 3341418 to 3338188)