Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3496390
End position: 3496413
Length: 24

DNA sequence
>NC_018828, from 3496390 to 3496413 (24 bp); Bordetella parapertussis Bpp5 CGCCAGCGACAGCCCCAGCGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3495614-3496954	Sequence	BN117_3239 - hypothetical protein (Protein is coded in complementary strand; from 3496954 to 3495614)