Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3719858
End position: 3719902
Length: 45

DNA sequence
>NC_018828, from 3719858 to 3719902 (45 bp); Bordetella parapertussis Bpp5 GGCCAAGAAGGCCTCGGCCAAGAAAGCCCCCGCCAAGACCGCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3719787-3720047	Sequence	BN117_3434 - hypothetical protein (Protein is coded in complementary strand; from 3720047 to 3719787)