Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3749795
End position: 3749818
Length: 24

DNA sequence
>NC_018828, from 3749795 to 3749818 (24 bp); Bordetella parapertussis Bpp5 GGCCAGCGCCAGGCCCAGGGCCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3749505-3749840	Sequence	BN117_3471 - hypothetical protein (Protein is coded in complementary strand; from 3749840 to 3749505)