Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3770159
End position: 3770182
Length: 24

DNA sequence
>NC_018828, from 3770159 to 3770182 (24 bp); Bordetella parapertussis Bpp5 GGCCCAGGCGCAGGCGCAGGCCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3769363-3771750	Sequence	BN117_3492 maeB NADP-dependent malic enzyme (Protein is coded in complementary strand; from 3771750 to 3769363)