Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3782536
End position: 3782562
Length: 27

DNA sequence
>NC_018828, from 3782536 to 3782562 (27 bp); Bordetella parapertussis Bpp5 GCGCCCAGCGCGCCCAGCGCGCCCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3779863-3782628	Sequence	BN117_3502 prn pertactin (Protein is coded in complementary strand; from 3782628 to 3779863)