Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 3823811
End position: 3823834
Length: 24

DNA sequence
>NC_018828, from 3823811 to 3823834 (24 bp); Bordetella parapertussis Bpp5 GCGGGTGCGGGTGCGGGTGCGGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 3821498-3824953	Sequence	BN117_3537 - hypothetical protein (Protein is coded in complementary strand; from 3824953 to 3821498)