Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 4187166
End position: 4187189
Length: 24

DNA sequence
>NC_018828, from 4187166 to 4187189 (24 bp); Bordetella parapertussis Bpp5 TCGACCTCGACCTCGATCTTGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4186926-4187831	Sequence	BN117_3894 nadC nicotinate-nucleotide pyrophosphorylase (Protein is coded in complementary strand; from 4187831 to 4186926)