Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 4217509
End position: 4217544
Length: 36

DNA sequence
>NC_018828, from 4217509 to 4217544 (36 bp); Bordetella parapertussis Bpp5 CCGACTCGCACGACGACTCGCACGACGACTCGCAAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4217367-4218335	Sequence	BN117_3923 - iron-sulfur oxidoreductase subunit (Protein is coded in complementary strand; from 4218335 to 4217367)