Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 4225035
End position: 4225079
Length: 45

DNA sequence
>NC_018828, from 4225035 to 4225079 (45 bp); Bordetella parapertussis Bpp5 TCACCGCGTCGATGATCAGCGCGTTGGTGATCACCGTGTCGACGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4223570-4225285	Sequence	BN117_3929 ureC urease subunit alpha (Protein is coded in complementary strand; from 4225285 to 4223570)