Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 428237
End position: 428261
Length: 25

DNA sequence
>NC_018828, from 428237 to 428261 (25 bp); Bordetella parapertussis Bpp5 CGGCGCGCCGCTGCGCGGCGCGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 428155-431103	Sequence	BN117_0415 ppc phosphoenolpyruvate carboxylase (Protein is coded in complementary strand; from 431103 to 428155)