Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 4288992
End position: 4289027
Length: 36

DNA sequence
>NC_018828, from 4288992 to 4289027 (36 bp); Bordetella parapertussis Bpp5 CGTAAGGCGGATCGAAGGGCGGATCGAAGGGCGGAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4288103-4289224	Sequence	BN117_3988 - membrane protein (Protein is coded in complementary strand; from 4289224 to 4288103)