Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 4406862
End position: 4406885
Length: 24

DNA sequence
>NC_018828, from 4406862 to 4406885 (24 bp); Bordetella parapertussis Bpp5 CAGCGCCAGGGCCAGCGCCAGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4405255-4406934	Sequence	BN117_4095 - ABC transporter ATP-binding protein (Protein is coded in complementary strand; from 4406934 to 4405255)