Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 4599716
End position: 4599739
Length: 24

DNA sequence
>NC_018828, from 4599716 to 4599739 (24 bp); Bordetella parapertussis Bpp5 GCCAGCCCCAGCTCCAGCGCCAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 4599143-4599949	Sequence	BN117_4290 - transcriptional regulator (Protein is coded in complementary strand; from 4599949 to 4599143)