Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 550990
End position: 551013
Length: 24

DNA sequence
>NC_018828, from 550990 to 551013 (24 bp); Bordetella parapertussis Bpp5 CAGCGGCACCGGCAGGGGCAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 550193-551344	Sequence	BN117_0521 - secreted protein (Protein is coded in complementary strand; from 551344 to 550193)