Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 69393
End position: 69422
Length: 30

DNA sequence
>NC_018828, from 69393 to 69422 (30 bp); Bordetella parapertussis Bpp5 GCCGCGAGCGACCGCGCGCGGGCGCGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 69030-69689	Sequence	BN117_0074 - glutathione S-transferase (Protein is coded in complementary strand; from 69689 to 69030)