Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 757082
End position: 757117
Length: 36

DNA sequence
>NC_018828, from 757082 to 757117 (36 bp); Bordetella parapertussis Bpp5 CCGCGCCGATGGCCGCGCCGTTGACGGCGGCGATGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 756622-757431	Sequence	BN117_0708 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 757431 to 756622)