Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 763677
End position: 763712
Length: 36

DNA sequence
>NC_018828, from 763677 to 763712 (36 bp); Bordetella parapertussis Bpp5 CAGGGCGCTGAACAGGGCGGTGAACAGGGCGGTGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 763573-764457	Sequence	BN117_0715 - branched-chain amino acid ABC transporter permease (Protein is coded in complementary strand; from 764457 to 763573)