Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 789735
End position: 789764
Length: 30

DNA sequence
>NC_018828, from 789735 to 789764 (30 bp); Bordetella parapertussis Bpp5 TGCTGCTGCCGCCGCTGCTGCCGCTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 788690-790327	Sequence	BN117_0737 - type II secretion system protein (Protein is coded in complementary strand; from 790327 to 788690)