Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 791202
End position: 791228
Length: 27

DNA sequence
>NC_018828, from 791202 to 791228 (27 bp); Bordetella parapertussis Bpp5 CGGCGGGCGCGGCGGGCTCGGGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 790850-791308	Sequence	BN117_0739 - hypothetical protein (Protein is coded in complementary strand; from 791308 to 790850)