Sequence retrieval

Genome: Bordetella parapertussis Bpp5
Start position: 971191
End position: 971217
Length: 27

DNA sequence
>NC_018828, from 971191 to 971217 (27 bp); Bordetella parapertussis Bpp5 GTGCCGCCGATGCCGCCGATGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 970972-971871	Sequence	BN117_0891 - binding-protein-dependent transport system inner membrane protein (Protein is coded in complementary strand; from 971871 to 970972)