Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 2018854
End position: 2018898
Length: 45

DNA sequence
>NC_018876, from 2018854 to 2018898 (45 bp); Methanolobus psychrophilus R15 CATCTGTGACATTGTCATCTGTAACATTGTCATCTGTGGCATTGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 2018790-2020535	Sequence	Mpsy_2082 - hypothetical protein (Protein is coded in complementary strand; from 2020535 to 2018790)