Sequence retrieval

Genome: Methanolobus psychrophilus R15
Start position: 566841
End position: 566885
Length: 45

DNA sequence
>NC_018876, from 566841 to 566885 (45 bp); Methanolobus psychrophilus R15 ACTGGTGCTTCTTCTACTGGTGCTTTTTCTACTGGTGCTTTTTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 565062-568166	Sequence	Mpsy_0582 - cell surface protein (Protein is coded in complementary strand; from 568166 to 565062)