Sequence retrieval

Genome: Streptococcus pyogenes A20
Start position: 1082137
End position: 1082160
Length: 24

DNA sequence
>NC_018936, from 1082137 to 1082160 (24 bp); Streptococcus pyogenes A20 CTTCATTTTCATCCTCATGTTCAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3

Gene(s) or part of gene(s) amplified:
ORF. 1082109-1084487	Sequence	A20_1143c inlA leucine Rich Repeat family protein (Protein is coded in complementary strand; from 1084487 to 1082109)